| RGN Home | Vol. 18 >C. Research Notes>V. Gene and genome structure |
| 41. | Development of dihaploid transgenic "golden rice" homozygous for genes involved in the metabolic pathway for beta-carotene biosynthesis |
| N. BAISAKH1, K. DATTA1, M. RAI1,
S. REHANA1, P. BEYER2, I. POTRYKUS3, and
S. K. DATTA1 1)Plant Breeding, Genetics and Biochemistry Division, International Rice Research Institute, DAPO Box 7777, Metro Manila, Philippines 2)University of Frieburg, Center for Applied Biosciences, D-79104 Frieburg, Germany, 3)Institute of Plant Sciences, Swiss Federal Institute of Technology, CH-8092, Zurich, Switzerland |
| The development of a transgenic rice cv. Taipei-309 (golden
rice) that carries three genes, psy (phytoene synthase), crt1
(phytoene desaturase), and lcy (lycopene cyclase) required for the
biosynthesis of b-carotene in the seeds (Ye et al. 2000) represents
an exciting scientific breakthrough in transgenic research. All these three
genes function coordinately to produce the beta-carotene. Homozygous lines
are required for future testing/evaluation of the transgenics in the field
or to be used in further cross-breeding to transfer these useful genes into
indica background. Normally, selection of the homozygous lines fixed for
all three genes (if integrated in three independent loci of the genome)
would be time consuming requiring more generations. Anther culture, on the other hand reduces the breeding cycle by rapid fixation of homozygosity and increased selection efficiency through the production of doubled haploid (DH) lines (Datta et al. 1990a). The first transgenic homozygous indica rice was reported based on microspore-derived protoplast culture (Datta et al. 1990b). Anther culture could successfully complement transgenic research to rapidly develop and make the homozygous lines readily available for further evaluation and field-release. This could be possible by using the anther/ pollen-derived haploid calli as the target tissue for transformation and/or the anther culture of the first generation transgenics to produce the DH lines. Employing anther culture of primary transgenics, homozygous transgenics was developed in less than one year starting from transformation (Baisakh et al. 2001). Herewith, we report on the production of the dihaploid lines from the segregating lines of T-309 that carry three genes for b-carotene biosynthesis. The seeds were grown to maturity in the transgenic greenhouse of IRRI. The anther culture procedures, PCR conditions, and Southern blot analyses were essentially the same as described before (Baisakh et al. 2001; Datta et al. 1990a; Datta et al. 2000). For both PCR and Southern, leaf tissues were used for extraction of DNA. The primer pairs used were designed specific to psy, crt1 and lcy coding sequences and are given below. psy F: tggtggttgcgatattacga psy R: accttcccagtgaacacgtc
crtI F: ggtcgggcttatgtctacga crtI R: atacggtcgcgtagttttgg lcy F: ccaatccccagaaccctaat lcy R: ctcgctaccatgtaacccgt The PCR results showed some progeny plants not carrying psy, crt1 or lcy gene (for example see Fig. 1 for psy) indicating that the plant was not homozygous. Moreover as evident from the figure some progeny plants were negative for psy but positive for lcy. This shows that these genes were not integrated into a single locus. This could be possible as these two genes were harbored in two different transformation vectors. We obtained altogether 28 green plants from anther culture of the boots collected from the plants positive for all three genes. Of these, 10 plants were doubled haploids identified on the basis of the phenotypic traits (Fig. 2). The anther culture derived plants were subjected to PCR, which showed segregation for the three genes (data not shown). This was confirmed by the Southern blot analysis (Fig. 3) where the 3.5-kb band corresponding to the crt1 expression cassette was absent in the negative plants. Interestingly, the transgenic DHs positive for crt1 gene showed differential banding pattern: some plants had only the expected band, some had a rearranged copy, and the others had both the bands. This is an expected case of independent
|
| RGN Home | Vol. 18>C. Research Notes>V. Gene and genome structure |